View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0295_low_12 (Length: 235)
Name: NF0295_low_12
Description: NF0295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0295_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 4 - 231
Target Start/End: Original strand, 51905200 - 51905427
Alignment:
| Q |
4 |
ctcttttctctttcttgtatgaattgctctgtccgtgctcctcgagaagccaatttgttcgtatcatgataggtttgcccaagcaatttatcttttagtt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51905200 |
ctcttttctctttcttgtatgaattgctctgtccgtgctcctcgagaagccaatttgttcgtatcatgataggtttgcccaagcaatttatcttttagtt |
51905299 |
T |
 |
| Q |
104 |
gtgtgtgcatgttgataaccgttgatgcatattcaacataaggaaatttgatcggacatttaagtgaacaattttaaagagtatgaaggcaagaatcatt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51905300 |
ctgtgtgcatgttgataaccgttgatgcatattcaacataaggaaatttgatcggacatttaagtgaacaattttaaagagtatgaaggcaagaatcatt |
51905399 |
T |
 |
| Q |
204 |
caagagtctataaagtttgcaagaagaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
51905400 |
caagagtctataaagtttgcaagaagaa |
51905427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University