View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0295_low_6 (Length: 313)
Name: NF0295_low_6
Description: NF0295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0295_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 43 - 246
Target Start/End: Original strand, 14803566 - 14803769
Alignment:
| Q |
43 |
attttaccattcaatagtttgcttgtgatatataatttgtaagagattccttttattgagtagaccatacattgagtgcatctattaagaagcatgaata |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14803566 |
attttaccattcaatagtttgcttgtgatatataatttgtaagagattccttttattgagtagaccttacattgagtgcatctattaagaagcatgaata |
14803665 |
T |
|
| Q |
143 |
ttatgtactattatatgttttagttttttataattagtagcaaggtaaaaaacagtttgaattattggatattatatgtcacgaaaaaatacattcatct |
242 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
14803666 |
ttatgtactattatatgttttggttttttataattagtagcaaggtaaaaaacagtttgaattattggatattatatgtcacgaaaaaatacattcattt |
14803765 |
T |
|
| Q |
243 |
cact |
246 |
Q |
| |
|
|||| |
|
|
| T |
14803766 |
cact |
14803769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 754 times since January 2019
Visitors: 2568