View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0298_low_4 (Length: 270)

Name: NF0298_low_4
Description: NF0298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0298_low_4
NF0298_low_4
[»] chr3 (1 HSPs)
chr3 (50-244)||(47406908-47407102)


Alignment Details
Target: chr3 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 50 - 244
Target Start/End: Original strand, 47406908 - 47407102
Alignment:
50 aatcattaagaattggattcagttttggcataaatggaaatatgacttgcattactaactcaagttcaggcataaaggtaacttggggtttacaatggag 149  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||| ||||    
47406908 aatcattaagaattggattcagttttggcacaaatggaaatatgactgatattactaactcaagttcaggcataaaggtaacttggggtttacaagggag 47407007  T
150 caccccagtcggaaaccaaaataacaacacgtccatgaaataaagcaaaacatcaaaacagtatgagcttgggccctaatctaactctctgctcc 244  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
47407008 caccccagtcggaaaccaaaataacaacacgtccatgaaataaagcaaaacatcaaaacagtatgagcttgggccctaatctaactgtctgctcc 47407102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University