View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0299Ase24 (Length: 99)

Name: NF0299Ase24
Description: NF0299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0299Ase24
NF0299Ase24
[»] chr6 (2 HSPs)
chr6 (8-74)||(31537103-31537169)
chr6 (19-54)||(31531800-31531835)


Alignment Details
Target: chr6 (Bit Score: 59; Significance: 1e-25; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 8 - 74
Target Start/End: Original strand, 31537103 - 31537169
Alignment:
8 attcttttatctaatcaccatagcaaaagagattgatactcaatgcaagtgcttcttggatcgatac 74  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||    
31537103 attcttttatctaatcaccatagcaaaagagattgatactcaatacaagtgcttctgggatcgatac 31537169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 54
Target Start/End: Original strand, 31531800 - 31531835
Alignment:
19 taatcaccatagcaaaagagattgatactcaatgca 54  Q
    |||||||||||||||||||||||||||||| |||||    
31531800 taatcaccatagcaaaagagattgatactcgatgca 31531835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University