View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0299Ase24 (Length: 99)
Name: NF0299Ase24
Description: NF0299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0299Ase24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 59; Significance: 1e-25; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 8 - 74
Target Start/End: Original strand, 31537103 - 31537169
Alignment:
Q |
8 |
attcttttatctaatcaccatagcaaaagagattgatactcaatgcaagtgcttcttggatcgatac |
74 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
T |
31537103 |
attcttttatctaatcaccatagcaaaagagattgatactcaatacaagtgcttctgggatcgatac |
31537169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 54
Target Start/End: Original strand, 31531800 - 31531835
Alignment:
Q |
19 |
taatcaccatagcaaaagagattgatactcaatgca |
54 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||| |
|
|
T |
31531800 |
taatcaccatagcaaaagagattgatactcgatgca |
31531835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University