View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0299Ase27 (Length: 75)

Name: NF0299Ase27
Description: NF0299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0299Ase27
NF0299Ase27
[»] chr2 (1 HSPs)
chr2 (15-75)||(40021398-40021458)
[»] chr6 (1 HSPs)
chr6 (28-75)||(11262005-11262052)


Alignment Details
Target: chr2 (Bit Score: 57; Significance: 2e-24; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 57; E-Value: 2e-24
Query Start/End: Original strand, 15 - 75
Target Start/End: Complemental strand, 40021458 - 40021398
Alignment:
15 tttgaagatatttgtaacaccctaaaccctgcatactatttgtagatagtaattcaacaat 75  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
40021458 tttgaagatatatgtaacaccctaaaccctgcatactatttgtagatagtaattcaacaat 40021398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.000000000005; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 75
Target Start/End: Original strand, 11262005 - 11262052
Alignment:
28 gtaacaccctaaaccctgcatactatttgtagatagtaattcaacaat 75  Q
    |||||||||||||||||||||||||||| || ||| ||||||||||||    
11262005 gtaacaccctaaaccctgcatactatttttaaataataattcaacaat 11262052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University