View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0299Ase27 (Length: 75)
Name: NF0299Ase27
Description: NF0299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0299Ase27 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 57; Significance: 2e-24; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 2e-24
Query Start/End: Original strand, 15 - 75
Target Start/End: Complemental strand, 40021458 - 40021398
Alignment:
Q |
15 |
tttgaagatatttgtaacaccctaaaccctgcatactatttgtagatagtaattcaacaat |
75 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40021458 |
tttgaagatatatgtaacaccctaaaccctgcatactatttgtagatagtaattcaacaat |
40021398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 75
Target Start/End: Original strand, 11262005 - 11262052
Alignment:
Q |
28 |
gtaacaccctaaaccctgcatactatttgtagatagtaattcaacaat |
75 |
Q |
|
|
|||||||||||||||||||||||||||| || ||| |||||||||||| |
|
|
T |
11262005 |
gtaacaccctaaaccctgcatactatttttaaataataattcaacaat |
11262052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University