View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0299Eco4 (Length: 311)

Name: NF0299Eco4
Description: NF0299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0299Eco4
NF0299Eco4
[»] chr3 (1 HSPs)
chr3 (9-311)||(35743937-35744239)
[»] chr2 (1 HSPs)
chr2 (161-225)||(45512271-45512335)


Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 9 - 311
Target Start/End: Complemental strand, 35744239 - 35743937
Alignment:
9 gtctcattgcgaattaagaaaanggacntcttntttcttcatcaagcaatggcacttcaaacggaaaannggangtgatgtttatgtnnnnnnnnttgat 108  Q
    |||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||  ||| |||||||||||||        |||||    
35744239 gtctcattgcgaattaagaaaatggacatcttatttcttcatcaagcaatggcacttcaaacggaaaaatggaagtgatgtttatgtaaaaaaaattgat 35744140  T
109 cgagaanggaagntttttcttttgtnctncaangggtgnttaancagaggtngtgtgaggggaggccaatgtctttttaaaaaatagaggggaggngagt 208  Q
    |||||| ||||| |||||||||||| || ||| ||||| |||| ||||||| ||||||||||||| ||||||||||||||||||||||||||||| ||||    
35744139 cgagaatggaaggtttttcttttgttcttcaaagggtgattaaacagaggtagtgtgaggggaggtcaatgtctttttaaaaaatagaggggaggtgagt 35744040  T
209 gatatttggttagaactagaggaggttaatgtaatttttccaaataataaacataaaaatctagacttcggcgcangtngngccaaancanccccccttg 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || || | |||||| || || ||||||    
35744039 gatatttggttagaactagaggaggttaatgtaatttttccaaataataaacataaaaagctagacttcggcacaagttgtgccaaaacatccacccttg 35743940  T
309 aat 311  Q
    |||    
35743939 aat 35743937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 161 - 225
Target Start/End: Complemental strand, 45512335 - 45512271
Alignment:
161 gtgtgaggggaggccaatgtctttttaaaaaatagaggggaggngagtgatatttggttagaact 225  Q
    ||||||||||||| ||| ||||||| ||||||||||||||||| |||||| | ||||||||||||    
45512335 gtgtgaggggaggtcaaagtcttttgaaaaaatagaggggaggtgagtgacacttggttagaact 45512271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 371 times since January 2019
Visitors: 2564