View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0299Eco7 (Length: 99)
Name: NF0299Eco7
Description: NF0299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0299Eco7 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 2e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 8 - 99
Target Start/End: Original strand, 8676227 - 8676318
Alignment:
| Q |
8 |
atcacaactatcataatttaaatgaaatacaatttttcgaggaggtttgaacttagtggaagagactagatttgcacaatgtagcaaatttg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8676227 |
atcacaactatcataatttaaatgaaatacaatttttcgaggaggtttgaacctagtggaagagactagatttgcccaatgtagcaaatttg |
8676318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 61 - 99
Target Start/End: Original strand, 8642500 - 8642538
Alignment:
| Q |
61 |
tagtggaagagactagatttgcacaatgtagcaaatttg |
99 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
8642500 |
tagtgaaaaagactagatttgcacaatgtagcaaatttg |
8642538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 335 times since January 2019
Visitors: 2564