View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0300_low_4 (Length: 380)
Name: NF0300_low_4
Description: NF0300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0300_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 36 - 372
Target Start/End: Original strand, 32403171 - 32403507
Alignment:
Q |
36 |
aacattgaacttatgtgctaactgcgtgaatgcgtagaattgctcactgcatgcaaactaaattcatttccttttgcttaatggtttctttgcttataat |
135 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32403171 |
aacattgaacttatgtgctaactgcgtgaatgcgtagaattgctcactgcatgcaaactaaattcatttccttttgcttaatggtttctttgcttataat |
32403270 |
T |
 |
Q |
136 |
ctcaaactgaattcttgttttagaattatctctacatgatgtatgacattttcaggaagtccacgtgtggcaagcatagtcatgtcttctgctgcaagaa |
235 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32403271 |
ctcaaactgaattcttgttctagaattatctctacatgatgtatgacattttcaggaagtccacgtgtggcaagcatagtcatgtcttctgctgcaagaa |
32403370 |
T |
 |
Q |
236 |
atttaactcctgttactctagagctaggtggaaaatgccctgctatatttgattatccttcagactttaaggtaattcacataacggttcgtgaccgcaa |
335 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32403371 |
atttaactcctgttactctagagctaggtggaaaatgccctgctatatttgattatccttcagactttaaggtaattcacataacggttcgtgaccgcaa |
32403470 |
T |
 |
Q |
336 |
attgtggtcacatgtcaagatttttgttgtctctgct |
372 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
32403471 |
attgtggtcacatgtcaagatttttgttgtctctgct |
32403507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 99; Significance: 9e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 190 - 292
Target Start/End: Complemental strand, 6664730 - 6664628
Alignment:
Q |
190 |
ggaagtccacgtgtggcaagcatagtcatgtcttctgctgcaagaaatttaactcctgttactctagagctaggtggaaaatgccctgctatatttgatt |
289 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6664730 |
ggaagtccacgtgtggcaagcatagtcatgtcttctgctgcaagatatttaactcctgttactctagagctaggtggaaaatgccctgctatatttgatt |
6664631 |
T |
 |
Q |
290 |
atc |
292 |
Q |
|
|
||| |
|
|
T |
6664630 |
atc |
6664628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 191 - 292
Target Start/End: Complemental strand, 43304928 - 43304827
Alignment:
Q |
191 |
gaagtccacgtgtggcaagcatagtcatgtcttctgctgcaagaaatttaactcctgttactctagagctaggtggaaaatgccctgctatatttgatta |
290 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
43304928 |
gaagtccacgtgtggcaagcatagtcatgtcttttgctgcaagatatttaactcctgttactcgagagctaggtggaaaatgccctgctatatttgatta |
43304829 |
T |
 |
Q |
291 |
tc |
292 |
Q |
|
|
|| |
|
|
T |
43304828 |
tc |
43304827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 282 times since January 2019
Visitors: 2563