View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0301-INSERTION-10 (Length: 101)
Name: NF0301-INSERTION-10
Description: NF0301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0301-INSERTION-10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 58; Significance: 6e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 6e-25
Query Start/End: Original strand, 8 - 69
Target Start/End: Original strand, 47126926 - 47126987
Alignment:
| Q |
8 |
ctttcccaaatcaatatattcattgtaatattttttataggtagaggaagcattggcaattg |
69 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47126926 |
ctttcccaaatcaatatattcattgtaattttttttataggtagaggaagcattggcaattg |
47126987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 63 - 101
Target Start/End: Original strand, 47126892 - 47126930
Alignment:
| Q |
63 |
gcaattggtagtaaccaagaagcacaaaagaggtctttc |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47126892 |
gcaattggtagtaaccaagaagcacaaaagaggtctttc |
47126930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University