View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0301-INSERTION-9 (Length: 123)
Name: NF0301-INSERTION-9
Description: NF0301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0301-INSERTION-9 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 1e-63; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 20068146 - 20068268
Alignment:
| Q |
1 |
ctttctgtgataggtttttagggttttttgggaatgtcagtcgtaggtttaggtctaagggtgttcattgtagttggattggtgttaatagtgatgataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20068146 |
ctttctgtgataggtttttagggttttttgggaatgtcagtcgtaggtttaggtctaagggtgttcattgtagttggattggtgttaatagtgatgataa |
20068245 |
T |
|
| Q |
101 |
ggaggatgaggttggtatgattc |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
20068246 |
ggaggatgaggttggtatgattc |
20068268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 191 times since January 2019
Visitors: 2563