View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0302_1D_high_9 (Length: 343)
Name: NF0302_1D_high_9
Description: NF0302_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0302_1D_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 7 - 335
Target Start/End: Original strand, 34638014 - 34638342
Alignment:
Q |
7 |
cagacattcctaatctcccttaccttcaagccatagtaaaggaggtgcttcgactacacccaccgggcccactattatcatgggcccgccttgcagtcca |
106 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34638014 |
cagacattcctaatctcccttaccttcaagccatagtaaaggaggtgcttcgactgcacccaccgggcccactattatcatgggcccgccttgcagtcca |
34638113 |
T |
 |
Q |
107 |
tgacgttcatgtagataaaactcttgtgccagctggcacaacagcaatggtaaacatgtgggctatatctcatgactcctctatttgggaagatccattg |
206 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
34638114 |
tgacgttcatgtagataaaacccttgtgccagctggcacaacagcaatggtaaacatgtgggctatatctcatgattcctctatttgggaagatccattg |
34638213 |
T |
 |
Q |
207 |
acttttaagcccgagcgatttctaaaagaagatgtttctattatgggctcggacttgaggcttgcaccttttggtgcaggtcgtagggtttgtccaggaa |
306 |
Q |
|
|
|||||||| || || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34638214 |
acttttaatccagaacgatttctaaaagaagatgtttctgttatgggctcggacttgaggcttgcaccttttggtgcaggtcgtagggtttgtccaggaa |
34638313 |
T |
 |
Q |
307 |
gagccctaggcttagccacggttcatctc |
335 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
34638314 |
gagccctaggcttagccacggttcatctc |
34638342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University