View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0302_1D_low_10 (Length: 365)
Name: NF0302_1D_low_10
Description: NF0302_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0302_1D_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 3 - 358
Target Start/End: Original strand, 7752511 - 7752866
Alignment:
| Q |
3 |
caatgcctcagtcttcacaacctgggatcctatcactgactgctgtaaaaattggtcaggcatagaatgcaattcaaatggccgtgtgaccatgcttgca |
102 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7752511 |
caatgcctcagtcttcacaacatgggatcctatcactgactgctgtaaaaattggtcaggcatagaatgcaattcaaatggccgtgtgaccatgcttgca |
7752610 |
T |
 |
| Q |
103 |
gttagtgacaccaatgacgtcgttggcgagatcccaacatcggtagtaaaccttccgttcctccaatttttcacattcgctgtctttcccggtgtctctg |
202 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
7752611 |
gttagtgacaccaatgacgtcattggcgagatcccaacctcggtagtaaaccttccgttcctccaattttttacatttgctgtctttcccggtgtctctg |
7752710 |
T |
 |
| Q |
203 |
ggacaatccctccggccattgcaaagctcaccaaccttgtccacctcgactttagcttggacagtctcaccggcccaatccctgatttcttaggtcaact |
302 |
Q |
| |
|
| ||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7752711 |
gtacaatccctccagccattgcaaagctcactaaccttgttcacctcgactttagcttggacagtctcacaggcccaatccctgatttcttaggtcaact |
7752810 |
T |
 |
| Q |
303 |
caagaacctcgatgtcatcgacctctccgggaacaggtttaccggccaaatccctg |
358 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7752811 |
caagaacctcgatgtcatcgacctctctgggaacaggtttaccggccaaatccctg |
7752866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University