View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0302_1D_low_12 (Length: 339)
Name: NF0302_1D_low_12
Description: NF0302_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0302_1D_low_12 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 24 - 339
Target Start/End: Original strand, 7750768 - 7751083
Alignment:
Q |
24 |
ggaattgggccggaaaggctgttggaagagaagtcaatgaaagttaggcccttgagtagggcaagaaaactaggaattgggcctgtgaggttatttaggc |
123 |
Q |
|
|
||||||||||||||||||||||||||||||||||| || ||| ||| |||||||||||||| ||||||||||||||||||||||| ||||| ||||||| |
|
|
T |
7750768 |
ggaattgggccggaaaggctgttggaagagaagtcgataaaatttacgcccttgagtagggttagaaaactaggaattgggcctgtaaggttgtttaggc |
7750867 |
T |
 |
Q |
124 |
tgaggtcgaggtgcaaaaggttggttaacttcgcgagggatgaagggatttcaccagacacatggggtaaagcggagaattggagaacttgaagaaatgg |
223 |
Q |
|
|
|||||||||| || | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7750868 |
tgaggtcgagatggacaaggttggataacttcgcgagggatgaagggatttcaccagacacatggggtaaagcggagaattggagaacttgaagaaatgg |
7750967 |
T |
 |
Q |
224 |
gagatttcctaccgaggatgggaattcgttgttgatgtcatccgcattaatgactacaagcgaattgacacggccattcgtgtcacacgtgatgcctgtc |
323 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||||||| |
|
|
T |
7750968 |
gagatttcctaccgaggatggaaattcgttgttgatgtcatccgcattaatgactataagcgaattgacacgaccattcgtgtcacacgcgatgcctgtc |
7751067 |
T |
 |
Q |
324 |
cagttctggcagcagt |
339 |
Q |
|
|
|||||||||||||||| |
|
|
T |
7751068 |
cagttctggcagcagt |
7751083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University