View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0302_1D_low_13 (Length: 332)
Name: NF0302_1D_low_13
Description: NF0302_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0302_1D_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 23 - 316
Target Start/End: Original strand, 45782979 - 45783278
Alignment:
| Q |
23 |
actttagcattttgtatatacgataccggttaggaattgttacaaatgagatgcttgcgattccaaaatggcggttttttgttatcgggtttttggaagc |
122 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45782979 |
actttagcattttgtacatacgataccggttaggaattgttacaaatgagatgcttgcgattccaaaatggcggttttttgttattgggtttttggaagc |
45783078 |
T |
 |
| Q |
123 |
tttgggattggtttctggaatgtctgctggaggtactgtttctgtttctgattcagctagattgtaattttctg-----nnnnnnnnnattttattgtct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
45783079 |
tttgggattggtttctggaatgtctgctggaggtactgtttctgtttctgattcagctagattgtaattttctgtttttttttttttttttttattgt-t |
45783177 |
T |
 |
| Q |
218 |
tgtgt--gtattgagtttgtttattcaagtgaggcgagcaagaataaaagtaatttgaggcaccgtgtttgaattaacttatttgagcttatctgctatg |
315 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45783178 |
tgtgttcgtattgagtttgtttattcaagtgaggggagcaaaaataaaagtaatttgaggcacggtgtttgaattaacttatttgagcttatctgctatg |
45783277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 309
Target Start/End: Complemental strand, 30134283 - 30134255
Alignment:
| Q |
281 |
tgtttgaattaacttatttgagcttatct |
309 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30134283 |
tgtttgaattaacttatttgagcttatct |
30134255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University