View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0302_1D_low_19 (Length: 257)
Name: NF0302_1D_low_19
Description: NF0302_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0302_1D_low_19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 22 - 257
Target Start/End: Original strand, 52086510 - 52086744
Alignment:
| Q |
22 |
agaatatgacatcagaattaaggtagtttggattatagcctgcattcagaaataagaatcacagtcaatatttcactattttgtcnnnnnnnngaacatc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52086510 |
agaatatgacatcagaattaaggtagtttggattatagcctgcattcagaaataagaatcacagtcaatatttcactattttgtcaaaaaaa-gaacatc |
52086608 |
T |
 |
| Q |
122 |
atcaatatttcactacataaatatttatggaattaacttgcttaagcacatgatgctaaaaagaagaatgaaaattttgaaatattacataatttcaaca |
221 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52086609 |
atcaatatttcactacagaaatatttatggaattaacttgcttaagcacatgatgctaaaaagaagaatgaaaattttgaaatattacataatttcaaca |
52086708 |
T |
 |
| Q |
222 |
agatgttaataaaaggaagtacacagtgcacgctga |
257 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52086709 |
agatattaataaaaggaagtacacagtgcacgctga |
52086744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University