View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0302_1D_low_22 (Length: 252)
Name: NF0302_1D_low_22
Description: NF0302_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0302_1D_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 45784791 - 45785037
Alignment:
| Q |
1 |
gggggccattctctattcagttggatacatttccaatctgttagcacttctctggt---------gattttgttagccagtatattagttattttaatgt |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
45784791 |
gggggccattctctattcagttggatacatttccaatctgttagcacttctctggtgattttggtgattttgttagccagtatattagttattttaatgt |
45784890 |
T |
 |
| Q |
92 |
gcaacataaattctctaaacattgtaaattctttatattgcagacttttttagtttggcagttgatgttttccgctcttatcctgaggagaaggtactca |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45784891 |
gcaacataaattctctaaacattgtaaattctttatattgcagacttttttagtttggcagttgatgttttccgctcttatcctgaggagaaggtactca |
45784990 |
T |
 |
| Q |
192 |
attaaccaaattgttgggtgtttactagtagctgctggtgtggtgat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45784991 |
attaaccaaattgttgggtgtttactagtagctgctggtgtggtgat |
45785037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University