View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0302_1D_low_28 (Length: 203)
Name: NF0302_1D_low_28
Description: NF0302_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0302_1D_low_28 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 4 - 203
Target Start/End: Original strand, 18996451 - 18996650
Alignment:
| Q |
4 |
atgaatcaacttaaaagcatcagctactgagaaatatcttgatggcttcaaaacacgtacgttgaaccctacatcttcagctaacttgatgacttcttct |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18996451 |
atgaatcaacttaaaagcatcagctactgagaaatctcttgatggcttcaaaacacgtacgttgaaccctacatcttcagctaactttatgacttcttct |
18996550 |
T |
 |
| Q |
104 |
tcgttcaaaatatcacggctagtacttccttttctactcaccaatgtgagaatcggcttacccttactattaggatacacaaatgggatgtcctctttga |
203 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18996551 |
tcgttcaaaatatcacggctagaacttccttttctactcaccaatgtgagaatcggcttacccttactattaagatacacaaatgggatgtcctctttga |
18996650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 60 - 139
Target Start/End: Original strand, 18991451 - 18991530
Alignment:
| Q |
60 |
gtacgttgaaccctacatcttcagctaacttgatgacttcttcttcgttcaaaatatcacggctagtacttccttttcta |
139 |
Q |
| |
|
|||| ||||||||||| |||| ||||||||||| ||||||||||| ||||||||| |||| || | |||||| |||||| |
|
|
| T |
18991451 |
gtacattgaaccctacttctttagctaacttgacgacttcttcttggttcaaaatcacacgactcgaacttccctttcta |
18991530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University