View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0302_1D_low_6 (Length: 403)
Name: NF0302_1D_low_6
Description: NF0302_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0302_1D_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 22 - 385
Target Start/End: Complemental strand, 23034325 - 23033962
Alignment:
| Q |
22 |
acaagaacaaaaagagttcattagtttggagaattgtattcaatggacacagaagctgaaactgtgcagcctcaggctgcaccagtaagggctcaaagga |
121 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23034325 |
acaagaacaaaaggagttcattagtttggagaattgtattcaatggacacagaagctgaaactgtgcagcctcaggctgcaccagtaagggctcaaagga |
23034226 |
T |
 |
| Q |
122 |
agaaaatgacaaaacaattgacggggaagcgcgacgatacgccgttacattcggcagcaagagcagggaacatggcttctttgaaggatacagttgatgg |
221 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23034225 |
agaaaatgacgaaacaattgacggggaagcgcgacgatacgccgttacattcagcagcaagagcagggaacatggcttctttgaaggatacagttgatgg |
23034126 |
T |
 |
| Q |
222 |
tgctgaagagggtaaactgcgcgaaatatttgcaaagcagaatcaaggtggagaaacagcactttatgttgctgctgagtatggttatgttgatatggtt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23034125 |
tgctgaagagggtaaactgcgcgaaatatttgcaaagcagaatcaaggtggagaaacagcactttatgttgctgctgagtatggttatgttgatatggtt |
23034026 |
T |
 |
| Q |
322 |
agagagatgattcagtattatgatcttgctgatgctggaattaaagcaagaaatggttttgatg |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23034025 |
agagagatgattcagtattatgatcttgctgatgctggaattaaagcaagaaatggttttgatg |
23033962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 258 - 385
Target Start/End: Complemental strand, 41067149 - 41067022
Alignment:
| Q |
258 |
gcagaatcaaggtggagaaacagcactttatgttgctgctgagtatggttatgttgatatggttagagagatgattcagtattatgatcttgctgatgct |
357 |
Q |
| |
|
|||||| |||| |||||||||||| ||||||||||||||||||||||||||| ||||| | ||| | | |||||||| ||||||||||||||| |||| |
|
|
| T |
41067149 |
gcagaaccaagatggagaaacagctctttatgttgctgctgagtatggttatattgatgtcgttcggggaatgattcaatattatgatcttgcttgtgct |
41067050 |
T |
 |
| Q |
358 |
ggaattaaagcaagaaatggttttgatg |
385 |
Q |
| |
|
||||||||||||||||| |||||||||| |
|
|
| T |
41067049 |
ggaattaaagcaagaaacggttttgatg |
41067022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University