View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0302_high_2 (Length: 259)
Name: NF0302_high_2
Description: NF0302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0302_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 6089380 - 6089146
Alignment:
| Q |
1 |
gttgaatctacaaagatatggatctatgatttatggtggtggatgtgtgattcaagggttggttgaaggagggggaggaagtggtggttcagttccattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6089380 |
gttgaatctacaaagatatggatctatgatttatggtggtggaggtgtgattcaaggtttggttgaaggagg---aggaagtggtggttcagttccattt |
6089284 |
T |
 |
| Q |
101 |
actggatatgcttctgttttgaaggattctaggtttttgaaaccagctcaagaattgttggaagagatgtgtgatgtcggaaatcttggtgtttgtggtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6089283 |
actggatatgcttctgttttgaaggattctaggtttttgaaaccagctcaagaattgttggaagagatgtgtgatgttggaaatcttggtgtttgtggtg |
6089184 |
T |
 |
| Q |
201 |
agaaggttgttgttgttgctgattcttctttgatgatg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6089183 |
agaaggttgttgttgttgctgattcttctttgatgatg |
6089146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 98 - 177
Target Start/End: Complemental strand, 23676809 - 23676730
Alignment:
| Q |
98 |
tttactggatatgcttctgttttgaaggattctaggtttttgaaaccagctcaagaattgttggaagagatgtgtgatgt |
177 |
Q |
| |
|
||||| || ||||||||||||||||||| || |||||||||||||| || ||| |||| ||||| ||||| |||||||| |
|
|
| T |
23676809 |
tttacgggttatgcttctgttttgaagggatcgaggtttttgaaacctgcacaacaattattggatgagatatgtgatgt |
23676730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University