View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0302_high_3 (Length: 251)

Name: NF0302_high_3
Description: NF0302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0302_high_3
NF0302_high_3
[»] chr3 (1 HSPs)
chr3 (1-239)||(30885574-30885812)


Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 30885574 - 30885812
Alignment:
1 ctgatctctataatcttgacaggctaaaaatgttatgtgaatcaaaattgtgcgaagaaatcaatactgagaccgtagccacaacacttgccctggctga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||    
30885574 ctgatctctataatcttgacaggctaaaaatgttatgtgaatcaaaattgtgtgaagaaatcaatactgagaccgtagccacgacacttgccctggctga 30885673  T
101 gcaacaccattgtccacagctcaagacgatctgtttgaaatttattgcaaatccgacaaatttgggaggtgcgtgctattgcatgttattgtttgtacaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30885674 gcaacaccattgtccacagctcaagacgatctgtttgaaatttattgcaaatccgacaaatttgggaggtgcgtgctattgcatgttattgtttgtacaa 30885773  T
201 tgtttctgatgatactgcaggggtttgatttgatagtat 239  Q
    |||||||||||||||||||||||||||||||||||||||    
30885774 tgtttctgatgatactgcaggggtttgatttgatagtat 30885812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 654 times since January 2019
Visitors: 2568