View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0302_low_4 (Length: 251)
Name: NF0302_low_4
Description: NF0302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0302_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 30885574 - 30885812
Alignment:
| Q |
1 |
ctgatctctataatcttgacaggctaaaaatgttatgtgaatcaaaattgtgcgaagaaatcaatactgagaccgtagccacaacacttgccctggctga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30885574 |
ctgatctctataatcttgacaggctaaaaatgttatgtgaatcaaaattgtgtgaagaaatcaatactgagaccgtagccacgacacttgccctggctga |
30885673 |
T |
|
| Q |
101 |
gcaacaccattgtccacagctcaagacgatctgtttgaaatttattgcaaatccgacaaatttgggaggtgcgtgctattgcatgttattgtttgtacaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885674 |
gcaacaccattgtccacagctcaagacgatctgtttgaaatttattgcaaatccgacaaatttgggaggtgcgtgctattgcatgttattgtttgtacaa |
30885773 |
T |
|
| Q |
201 |
tgtttctgatgatactgcaggggtttgatttgatagtat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885774 |
tgtttctgatgatactgcaggggtttgatttgatagtat |
30885812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 474 times since January 2019
Visitors: 2566