View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0302_low_5 (Length: 251)
Name: NF0302_low_5
Description: NF0302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0302_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 11 - 223
Target Start/End: Complemental strand, 30885206 - 30884996
Alignment:
Q |
11 |
ccgtttattttgatagagacaactcaccctattttactctaccacaaacaattatttttataatatatatacccagtttcaactgactgcttcacaaaca |
110 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
T |
30885206 |
ccgtttattttgatagagacaactcaccctattttactctaccacaaacaattatttttataatataca--cccagtttcaactgactgcttcacaaaca |
30885109 |
T |
 |
Q |
111 |
aaagcaaacagattatttatgtgttcatatcatagtcacataattcattgcactcagtaaagaaatcgtgaattgtctccggggtaccattcacggtact |
210 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30885108 |
aaagcaaacagattatttatgtgttcatatcatagtcacataattcattgcactcggtagagaaatcgtgaattgtctccggggtaccattcacggtact |
30885009 |
T |
 |
Q |
211 |
tctataaattggt |
223 |
Q |
|
|
||| | ||||||| |
|
|
T |
30885008 |
tctgtgaattggt |
30884996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 312 times since January 2019
Visitors: 2564