View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0304-INSERTION-9 (Length: 252)
Name: NF0304-INSERTION-9
Description: NF0304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0304-INSERTION-9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 7 - 213
Target Start/End: Complemental strand, 10885899 - 10885693
Alignment:
Q |
7 |
atctccaagttggagattacctatagagagatgaaatcaatcaaggtactaagaagaagaaggaaggaaaatagtgtcaaaaataccatacaaaccattt |
106 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
10885899 |
atctccaagttggagattacctatagagagacgaaatcaatcaaggtactaagaagaagaaggaaggaaaatagtgtcaaaaataccatacaaatcattt |
10885800 |
T |
 |
Q |
107 |
gtaaaaaatgacacatcataatttttaagggtaaattagtcatttcaaattctttcttccctcatttcaaattccactctctctggccacttataaacca |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10885799 |
gtaaaaaatgacacatcataatttttaagggtaaattagtcatttcaaattctttcttccctcatttcaaattccactctctctggccacttataaacca |
10885700 |
T |
 |
Q |
207 |
ttctcac |
213 |
Q |
|
|
||||||| |
|
|
T |
10885699 |
ttctcac |
10885693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University