View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0304_1D_low_11 (Length: 315)
Name: NF0304_1D_low_11
Description: NF0304_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0304_1D_low_11 |
 | |
|
| [»] scaffold0006 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0006 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 313
Target Start/End: Complemental strand, 82372 - 82078
Alignment:
| Q |
19 |
atatcagccctgctagagagctctctccatggtgcttgggactcaatgcaagaaactcatatacagtcatcgcacctcatttcttccatgcgtgaaacaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
82372 |
atatcagccctgctagagagctctctccatggtgcttgggactcaatgcaagaaactccaatacagtcatcgcacctcatttcttccatggctgaaacaa |
82273 |
T |
|
| Q |
119 |
accgacaatgtagcctgcgtatggctgaatatgcatgagaaattagagagtcatgtgcacgaattctcaaactgttgcaagaggagattgatggttcccc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
82272 |
accgacaatgtagcctgcgtatggctgaatatgcatgagaaattagagagtcatgtgcacgaattctcaaactgttgcaagaggagattgatgattcccc |
82173 |
T |
|
| Q |
219 |
acggttcaggtgttggaggattcacttcgttccatggaacaagagggatcggattttgccaccgattcatatttgaatttcgtaaccaacaccaa |
313 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
82172 |
acggttcagctgttggaggattcgcttccttccatggaaccagagggatcggattttgccaccgattcatatttgaatttcgtaaccatcaccaa |
82078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 198 - 280
Target Start/End: Complemental strand, 130903 - 130821
Alignment:
| Q |
198 |
agaggagattgatggttccccacggttcaggtgttggaggattcacttcgttccatggaacaagagggatcggattttgccac |
280 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||| |||||||| |||| ||||||||||| |||||||| || || |||||| |
|
|
| T |
130903 |
agaggagattgatgcttcccaacggttcaggtgtcagaggattcgcttccttccatggaactagagggattgggttctgccac |
130821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 75; Significance: 2e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 34 - 273
Target Start/End: Original strand, 19152899 - 19153129
Alignment:
| Q |
34 |
gagagctctctccatggtgcttgggactcaatgcaagaaactcatatacagtcatcgcacctcatttcttccatgcgtgaaacaaaccgacaatgtagcc |
133 |
Q |
| |
|
||||||||| ||||||||| | ||||||| ||||||||| |||||||||| | ||||||||||||||| ||||||| ||| |||| |||| |
|
|
| T |
19152899 |
gagagctcttcccatggtgcgagaaactcaataaaagaaactccactacagtcatcacgtctcatttcttccatgacagaaacaacccggcaatatagca |
19152998 |
T |
|
| Q |
134 |
tgcgtatggctgaatatgcatgagaaattagagagtcatgtgcacgaattctcaaactgttgcaagaggagattgatggttccccacggttcaggtgttg |
233 |
Q |
| |
|
||| ||||||| ||||||||||||||||||||||||| |||||||| ||||| |||| |||||||||||||||||||| |||| ||||||| | |
|
|
| T |
19152999 |
tgcatatggct-aatatgcatgagaaattagagagtcgtgtgcacggattctgaaacagttgcaagaggagattgatgtttcc--------caggtgtcg |
19153089 |
T |
|
| Q |
234 |
gaggattcacttcgttccatggaacaagagggatcggatt |
273 |
Q |
| |
|
||||||||| ||| |||||||||||| ||| ||||||||| |
|
|
| T |
19153090 |
gaggattcaattccttccatggaacatgagagatcggatt |
19153129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 198 - 280
Target Start/End: Complemental strand, 13602246 - 13602164
Alignment:
| Q |
198 |
agaggagattgatggttccccacggttcaggtgttggaggattcacttcgttccatggaacaagagggatcggattttgccac |
280 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||| |||||||| |||| ||||||||||| |||||||| || || |||||| |
|
|
| T |
13602246 |
agaggagattgatgcttcccaacggttcaggtgtcagaggattcgcttccttccatggaactagagggattgggttctgccac |
13602164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1234 times since January 2019
Visitors: 2574