View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0304_1D_low_18 (Length: 260)
Name: NF0304_1D_low_18
Description: NF0304_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0304_1D_low_18 |
 |  |
|
[»] scaffold0006 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0006 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 19 - 220
Target Start/End: Complemental strand, 82372 - 82171
Alignment:
Q |
19 |
atatcagccctgctagagagctctctccatggtgcttgggactcaatgcaagaaactcatatacagtcatcgcacctcatttcttccatgcgtgaaacaa |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
T |
82372 |
atatcagccctgctagagagctctctccatggtgcttgggactcaatgcaagaaactccaatacagtcatcgcacctcatttcttccatggctgaaacaa |
82273 |
T |
 |
Q |
119 |
accgacaatgtagcctgcgtatggctgaatatgcatgagaaattagagagtcatgtgcacgaattctcaaactgttgcaagaggagattgatggttcccc |
218 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
82272 |
accgacaatgtagcctgcgtatggctgaatatgcatgagaaattagagagtcatgtgcacgaattctcaaactgttgcaagaggagattgatgattcccc |
82173 |
T |
 |
Q |
219 |
ac |
220 |
Q |
|
|
|| |
|
|
T |
82172 |
ac |
82171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 34 - 217
Target Start/End: Original strand, 19152899 - 19153081
Alignment:
Q |
34 |
gagagctctctccatggtgcttgggactcaatgcaagaaactcatatacagtcatcgcacctcatttcttccatgcgtgaaacaaaccgacaatgtagcc |
133 |
Q |
|
|
||||||||| ||||||||| | ||||||| ||||||||| |||||||||| | ||||||||||||||| ||||||| ||| |||| |||| |
|
|
T |
19152899 |
gagagctcttcccatggtgcgagaaactcaataaaagaaactccactacagtcatcacgtctcatttcttccatgacagaaacaacccggcaatatagca |
19152998 |
T |
 |
Q |
134 |
tgcgtatggctgaatatgcatgagaaattagagagtcatgtgcacgaattctcaaactgttgcaagaggagattgatggttccc |
217 |
Q |
|
|
||| ||||||| ||||||||||||||||||||||||| |||||||| ||||| |||| |||||||||||||||||||| ||||| |
|
|
T |
19152999 |
tgcatatggct-aatatgcatgagaaattagagagtcgtgtgcacggattctgaaacagttgcaagaggagattgatgtttccc |
19153081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University