View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0304_1D_low_19 (Length: 255)
Name: NF0304_1D_low_19
Description: NF0304_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0304_1D_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 17 - 125
Target Start/End: Original strand, 34899867 - 34899975
Alignment:
Q |
17 |
agacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaagtttggtagtttcaactttca |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34899867 |
agacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaagtttggtagtttcaactttca |
34899966 |
T |
 |
Q |
117 |
agttgagat |
125 |
Q |
|
|
||||||||| |
|
|
T |
34899967 |
agttgagat |
34899975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University