View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0304_1D_low_23 (Length: 248)
Name: NF0304_1D_low_23
Description: NF0304_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0304_1D_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 23 - 236
Target Start/End: Original strand, 53274003 - 53274214
Alignment:
| Q |
23 |
agaagttagatgaaggcatttcttgcaagcaataaatgagtgaaaaaattaagctgaaaagaaaagggagggaagaaagagtgagcatttgcaag---ta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| || |
|
|
| T |
53274003 |
agaagttagatgaaggcatttcttgcaagcaataaatgagtgaaaaaattcagctgaaaag-----ggagggaagaaagagtgagcatttgcaagaagta |
53274097 |
T |
 |
| Q |
120 |
gctaaacttattcttcaatgtgtaccttgatgatttgtttcttcatattattgggagttgtttcttacacaactaaggctagtttggcaacactagagct |
219 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53274098 |
gctagacttattcttcaatgtgtaccttaatgatttatttcttcatattattgggagttgtttcttacacaactaaggctagtttggcaacaatagagct |
53274197 |
T |
 |
| Q |
220 |
tccaccaaatgtttcat |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
53274198 |
tccaccaaatgtttcat |
53274214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University