View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0304_1D_low_24 (Length: 247)
Name: NF0304_1D_low_24
Description: NF0304_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0304_1D_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 20 - 210
Target Start/End: Complemental strand, 31304750 - 31304560
Alignment:
Q |
20 |
gttgttaactgtttgtaagannnnnnnngttgtgaattattgnnnnnnngtaaaaaattaattttgtgagaagagaaaataaattttaagtttgcaaaaa |
119 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31304750 |
gttgttaactgtttgtaagattttttttgttgtgaattattgtttttttgtaaaaaattaattttgtgagaagagaaaataaattttaagtttgcaaaaa |
31304651 |
T |
 |
Q |
120 |
gacaacctgcgagcgaatgagcgaagatcatgatgatgtttatatacatgtgaaactgccatgtgggtaatattgccacgtaggattaatg |
210 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
T |
31304650 |
gacaacctgcgagcgaatgagcgaagatcatgatgatgtttatatacatgtgaaactgccacgtgggtagtattgccacgtaggattaatg |
31304560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University