View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0304_1D_low_30 (Length: 232)
Name: NF0304_1D_low_30
Description: NF0304_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0304_1D_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 4 - 216
Target Start/End: Complemental strand, 15938707 - 15938495
Alignment:
| Q |
4 |
gatatgaagtgagagaaagatttgaatattttttgttgttggagtgttcatgtcaaagtgaaccgacaatttatgtggtacaaattaaactgaatgctat |
103 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15938707 |
gatatggagtgagagaaagatttgaatattttttgttgttggagtgttcatgtcaaagtgaaccgacaatttatgtggtacaaattaaactgaatgctat |
15938608 |
T |
|
| Q |
104 |
gtatttgcatttctttcaccttctttcaaaattcataacacacaaactttcgttttcttctaacaattacattatgtcaaagtgcaccgacacaaacaga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15938607 |
gtatttgcatttctttcaccttctttcaaaattcataacacacaaactttcgttttcttctaacaattacattatgtcaaagtgcaccgacacaaacaga |
15938508 |
T |
|
| Q |
204 |
gactaaacatgct |
216 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
15938507 |
gattaaacatgct |
15938495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1292 times since January 2019
Visitors: 2576