View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0304_1D_low_31 (Length: 227)
Name: NF0304_1D_low_31
Description: NF0304_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0304_1D_low_31 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 17 - 227
Target Start/End: Original strand, 43708769 - 43708979
Alignment:
| Q |
17 |
acatcagtttcgatatacggtctaataagttatcctgtttttccacattgttaacttatttttaaggctacaatcttacagcatgtgtgcagaaattact |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43708769 |
acatcagtttcgatatacggtctaataagttatcctgtttttccacattgttaacttatttttaaggctacaatcttacagcatgtgtgcagaaattact |
43708868 |
T |
|
| Q |
117 |
catgatgtgaaaacagcaaataatatttgtcaaacatatgtcaaccaactgcattagaaccaacaattacacaacaagtaaataatcaaattaataagat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43708869 |
catgatgtgaaaacagcaaataatatttgtcaaacatatgtcaaccaactgcattagaaccaacaattacacaacaagtaaataatcaaattaataagat |
43708968 |
T |
|
| Q |
217 |
tgtgtgttgag |
227 |
Q |
| |
|
||||| ||||| |
|
|
| T |
43708969 |
tgtgtattgag |
43708979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1117 times since January 2019
Visitors: 2572