View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0304_1D_low_33 (Length: 219)
Name: NF0304_1D_low_33
Description: NF0304_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0304_1D_low_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 8 - 204
Target Start/End: Complemental strand, 16438403 - 16438208
Alignment:
| Q |
8 |
ttggtgttgttgggttgggagtttgaattttaatggtgattttgagcgtggtggtgaattttggttgaagtgatgatgacgagtttgcgggttgattcca |
107 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| ||||| |
|
|
| T |
16438403 |
ttggtgttgttgggttagaagtttgaattttaatggtgattttgagcgtggtggtgaattttggttgaagtgatgatgaggagtttgtgggttggttcca |
16438304 |
T |
|
| Q |
108 |
tttttgggggtttgttttgtttctctttctttatctgctctttgtcaccttcgatttggatcaatctccactgtcgctgccatttttgtgttgatgt |
204 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||| ||| | |||||| |||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
16438303 |
tttttgagggtttgttttgtttttctttctttgtctac-ctttgttaccttcgatttggatccatctccaaagtcgctgccatttttgtgttgatgt |
16438208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 39041807 - 39041731
Alignment:
| Q |
8 |
ttggtgttgttgggttgggagtttgaattttaatggtgattttgagcgtggtggtgaattttggttgaagtgatgat |
84 |
Q |
| |
|
|||||| |||||| |||||||| |||| ||||| ||||| ||| | |||||||||||||||||||| |||||||| |
|
|
| T |
39041807 |
ttggtgatgttggactgggagttggaatgttaattgtgatcttgtgtgtggtggtgaattttggttgtggtgatgat |
39041731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 974 times since January 2019
Visitors: 2569