View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0304_1D_low_34 (Length: 211)
Name: NF0304_1D_low_34
Description: NF0304_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0304_1D_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 16 - 173
Target Start/End: Complemental strand, 27556581 - 27556424
Alignment:
| Q |
16 |
gtgttcatacagttgaaaactgtcaataaatgataaatctgtggtgtagaataggcaatagcacaacagcttttaaatagtgtaaaaatgatatatcatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27556581 |
gtgttcatacagttgaaaactgtcaataaatgataaatctgtggtgtagaataggcaatagcacaacagcttttaaatagtgtaaaaatgatatatcatc |
27556482 |
T |
 |
| Q |
116 |
agcagttcttaagatgtactttgctatagttatataactcaaacaatatgaactgatg |
173 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27556481 |
agcagtttttaagatgtactttgctatagttatataactcaaacaatatgaactgatg |
27556424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University