View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0304_1D_low_5 (Length: 430)
Name: NF0304_1D_low_5
Description: NF0304_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0304_1D_low_5 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 340; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 22 - 430
Target Start/End: Original strand, 50610826 - 50611235
Alignment:
| Q |
22 |
atttacacccctgaaatttgcgaataggccaacaaaagacgccaattttaaatgatatcaagcaactctgtccttctgttaacttggccaactgtcaaac |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50610826 |
atttacacccctgaaatttgcgaataggccaacgacagacgccaattttaaatgatatcaggcaactcggtccttctgttaacttggccaactgtcaaac |
50610925 |
T |
 |
| Q |
122 |
cagtaacggaaggactgagttgcctaatgtcgttcataattggagtca-ttttcttttcatgttcgtaaatttcagggtgtaaatgtttgacggctacaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50610926 |
cagtaacggaaggactgagttgcctaatgtcgttcataattggagtcatttttcttttcatgttcgtaaatttcagggtgtaaatgtttgacggctacaa |
50611025 |
T |
 |
| Q |
221 |
tttcagggggaattggcgatttgctaattaacttatgttccctagttaccccctcaatttgaagaaaaccannnnnnngtcatgtgcaattgattgactt |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
50611026 |
tttcagggggaattggcgatttgctaattaacttatgttccctagttaccccctcaatttgaagaaaaccatttttttgtcatgtacaattgattgactt |
50611125 |
T |
 |
| Q |
321 |
tgaattctgtgttttgttttgatgcagggtgattcaattcctaacctaattttgtagtttaggttaacaatcagggtgaggnnnnnnnttgcctctttgt |
420 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
50611126 |
tgaattctgtgttttgttttgatgcagggtgattcaattcctaacctaattttgtagtttaggttaacaatcagggtgaggaaaaaaattgcctctttgt |
50611225 |
T |
 |
| Q |
421 |
gagaggaaca |
430 |
Q |
| |
|
|||||||||| |
|
|
| T |
50611226 |
gagaggaaca |
50611235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 22 - 50
Target Start/End: Complemental strand, 2222959 - 2222931
Alignment:
| Q |
22 |
atttacacccctgaaatttgcgaataggc |
50 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2222959 |
atttacacccctgaaatttgcgaataggc |
2222931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University