View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0304_2D_low_12 (Length: 236)
Name: NF0304_2D_low_12
Description: NF0304_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0304_2D_low_12 |
 |  |
|
| [»] scaffold0743 (1 HSPs) |
 |  |  |
|
| [»] scaffold1104 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0743 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: scaffold0743
Description:
Target: scaffold0743; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 218
Target Start/End: Original strand, 6148 - 6347
Alignment:
| Q |
19 |
tgatcatatgttttgcattgaattcaatgtgatgagcttgcttccaaagacctagccatctttttgagaggatgttgcatctcacagcttcgtcaacatg |
118 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6148 |
tgatcatgtgttttgcattgaattcaatgtgatgagcttgcttccatagacctagccatctttttgagaggatgttgcatctcacagcttcgtcaacatg |
6247 |
T |
 |
| Q |
119 |
aagtttggaaaggatgaaggttaagacatcatttggaagcttgttgataaaatcttgtttctcatcactcataaccaccatcttttccatctctatgtct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6248 |
aagtttggaaaggatgaaggttaagacatcatttggaagcttgttgataaactcttgtttctcatcactcataaccaccatcttttccatctccatgtct |
6347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1104 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold1104
Description:
Target: scaffold1104; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 19 - 58
Target Start/End: Complemental strand, 286 - 247
Alignment:
| Q |
19 |
tgatcatatgttttgcattgaattcaatgtgatgagcttg |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
286 |
tgatcatatgttttgcattgaattcaatgtgatgagcttg |
247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University