View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0304_high_2 (Length: 458)
Name: NF0304_high_2
Description: NF0304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0304_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 275; Significance: 1e-153; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 275; E-Value: 1e-153
Query Start/End: Original strand, 29 - 356
Target Start/End: Original strand, 41854667 - 41855006
Alignment:
| Q |
29 |
acctgtggcgtggaaatgagtccaagattcgttgaggtaatcgagaagatcgttaacaatggaagcggattgggattttgaagatgtggaattggtggag |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41854667 |
acctgtggcgtggaaatgagtccaagattcgttaaggtaatcgagaagatcgttaacaatggaagcggattgggattttgaagatgtggaattggtggag |
41854766 |
T |
|
| Q |
129 |
cagaagacacgtcgtg------------atgaatttgggagattgcggtagcgaagaaatggtgacgatggtttgagattgagtttgagtgatggagatg |
216 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41854767 |
cagaagacacgtcgtggaatgaagggcgatgaatttgggagatttcggtagcgaagaaatggtgacgatggtttgagattgagtttgagtgatggagatg |
41854866 |
T |
|
| Q |
217 |
aagaatgcagaagaagaatgtgcggtcgagttattgttgatgccatgatgtttcaaactcagtcccaacactcataacaaacacccaacctctgtcaact |
316 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41854867 |
aagagtgcagaagtagaatgtgcggtcgagttattgttgatgccatgatgtttcaaacttagtcccaacactcataacaaacacccaacctctgtcaact |
41854966 |
T |
|
| Q |
317 |
agtattggatcaaggtggatatcgttagaatcgttgatga |
356 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41854967 |
agtattgcatcaaggtggatatcgttagaatcgttgatga |
41855006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 365 - 425
Target Start/End: Original strand, 41855055 - 41855115
Alignment:
| Q |
365 |
ggtgacccaaaaaataagtttaatgagtaaataacaagtcattatgtgatatccgtctcat |
425 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41855055 |
ggtgacccaaaaaataagtttaatgagtaaataacaagtcattatgtgatatccgtctcat |
41855115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1104 times since January 2019
Visitors: 2571