View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0305_low_10 (Length: 304)
Name: NF0305_low_10
Description: NF0305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0305_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 81 - 197
Target Start/End: Complemental strand, 515439 - 515323
Alignment:
| Q |
81 |
gaatgaggagagttagaatcgaaatattagcaaagaataagtcacagggaaccttgaccttcaagtttgtgatggatttggtagggggaaactatttata |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
515439 |
gaatgaggagagttagaatcgaaatattagcaaagaataagtcacaaggaaccttgaccttcaagtttgtgatggatttggtagggggaaactatttata |
515340 |
T |
 |
| Q |
181 |
gtaatttaatatcccca |
197 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
515339 |
gtaatttaatatcccca |
515323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University