View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0305_low_10 (Length: 304)

Name: NF0305_low_10
Description: NF0305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0305_low_10
NF0305_low_10
[»] chr5 (1 HSPs)
chr5 (81-197)||(515323-515439)


Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 81 - 197
Target Start/End: Complemental strand, 515439 - 515323
Alignment:
81 gaatgaggagagttagaatcgaaatattagcaaagaataagtcacagggaaccttgaccttcaagtttgtgatggatttggtagggggaaactatttata 180  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
515439 gaatgaggagagttagaatcgaaatattagcaaagaataagtcacaaggaaccttgaccttcaagtttgtgatggatttggtagggggaaactatttata 515340  T
181 gtaatttaatatcccca 197  Q
    |||||||||||||||||    
515339 gtaatttaatatcccca 515323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University