View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0305_low_18 (Length: 261)
Name: NF0305_low_18
Description: NF0305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0305_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 46018193 - 46018018
Alignment:
| Q |
1 |
tacctcaatctcacaaagtagccttgttggttctgaattttgtgatcaaatggcagccttgggagaaatgtcgtcgccatacttttctggagaagaggta |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46018193 |
tacctcaatctcacaaagtggccttgttggttctgaattttgtgatcaaatggcagccttgggagaaatgtcgtcgccatacttttctggagaagaggta |
46018094 |
T |
|
| Q |
101 |
tcacgggttggtctatttggaagttacacgttggaacaagtaaatgcaaatcctctgtcctttgtttatgatgatg |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46018093 |
tcacgggttggtctatttggaagttacacgttggaacaagtaaatgcaaatcctctgtcctttgtttatgatgatg |
46018018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 700 times since January 2019
Visitors: 2783