View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0305_low_6 (Length: 409)
Name: NF0305_low_6
Description: NF0305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0305_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 10 - 235
Target Start/End: Complemental strand, 42895440 - 42895215
Alignment:
| Q |
10 |
attattcttgcatttatgtgatttaaatggtcttaatagaatggccannnnnnnnncaatgcttggaactacccaacccaacccactctctataccatcc |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42895440 |
attactcttgcatttatgtgatttaaatggtcttaatagaatggccatttttttttcaatgcttggaactacccaacccaacccactctctataccatcc |
42895341 |
T |
|
| Q |
110 |
attgttttgtagttttactcatcctcctcctcctaacacaatcaaattttcttatactatacgacatacaactttcacgttattgctctcattatactcg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42895340 |
tttgttttgtagttttactcatcctcctcctcctaacacaatcaaattttcttatactatacgacatacaactttcacgttattgttctcattatactcg |
42895241 |
T |
|
| Q |
210 |
tggatacacatgacctagaaatgatg |
235 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42895240 |
tggatacacatgacctagaaatgatg |
42895215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 49
Target Start/End: Original strand, 25581412 - 25581451
Alignment:
| Q |
10 |
attattcttgcatttatgtgatttaaatggtcttaataga |
49 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25581412 |
attactcttgcatttatgtgatttaaatggtcttaataga |
25581451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 346 - 405
Target Start/End: Original strand, 4012263 - 4012322
Alignment:
| Q |
346 |
aactcaatggtgttatgagatttttgatgggtttagaacggaattcaagttacaattcac |
405 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| || |||||||||| || |||||||| |
|
|
| T |
4012263 |
aactcaatggttttatgcaatttttgatgggtttcgaccggaattcaatttccaattcac |
4012322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 537 times since January 2019
Visitors: 2776