View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0305_low_7 (Length: 385)
Name: NF0305_low_7
Description: NF0305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0305_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 6e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 28 - 165
Target Start/End: Original strand, 40662518 - 40662655
Alignment:
Q |
28 |
catcttctgtgtattcctatctttgatccttagtgtgtgtacaannnnnnnccatcacagacttatttgagaatgacaacatcgcaaatttttgatttac |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
T |
40662518 |
catcttctgtgtattcctatctttgatccttagtgtgtgtacaatttttttccatcacagacttatttgagaatgacaacatcacaggtttttgatttac |
40662617 |
T |
 |
Q |
128 |
cgagacagcaatgtaacaaaaatcttaaagtgtctaat |
165 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
T |
40662618 |
cgagacagcaatgtaacaaaaaccttaaagtgtctaat |
40662655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 461 times since January 2019
Visitors: 2766