View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0306_low_3 (Length: 473)
Name: NF0306_low_3
Description: NF0306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0306_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 30 - 378
Target Start/End: Original strand, 8008526 - 8008867
Alignment:
Q |
30 |
attcttggtgtgaatactatgttgttgctggtgactgcatggatttgaagggaacacatatcccattatatatgtttgctgaaggaaatatttgagaatc |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8008526 |
attcttggtgtgaatactatgttgttgctggtgactgcatggatttgaagggaacacatatcccattatatatgtttgctgaaggaaatatttgagaatc |
8008625 |
T |
 |
Q |
130 |
ataacaccaaagccttaaaattggcaagtgtagttggaagggaggctgagagaaatgaccaccaaacttattgcataaatgtgttgatccggtgtttcta |
229 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8008626 |
ataacaccaaagccttaaaattggaaagtgtagttggaagtgaggctgagagaaatgaccaccaaacttattgcataaatgtgttgatccggtgtttcta |
8008725 |
T |
 |
Q |
230 |
gagcccctatggaaccttagtacacttaatgggttgtcttgggttgctacgacgctagcatttctatatcactatttggctaattaagactactatatat |
329 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8008726 |
gagcccctatggaaccttagtacacttaa----------tgggttgctacgacgctagcatttctatatcactatttggctaattaagactactatatat |
8008815 |
T |
 |
Q |
330 |
tcttcgatagggt---tgataggtggatgttgtacccttctgcgggtaatta |
378 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
8008816 |
tcttcgatagggttgatgataggtggatgttgtacccttctgcgggtaatta |
8008867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University