View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0308_high_8 (Length: 251)

Name: NF0308_high_8
Description: NF0308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0308_high_8
NF0308_high_8
[»] chr5 (1 HSPs)
chr5 (9-89)||(15050388-15050468)


Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 9 - 89
Target Start/End: Complemental strand, 15050468 - 15050388
Alignment:
9 atcataggaggatggattagagaactaaatcatgtgttgaacacccattagagttatctgtgtttgacggaaagtgttgag 89  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||    
15050468 atcataggaggatggattagagaactaaatcatgtgttgaacacccattagagttatctgtgctcgacggaaagtgttgag 15050388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University