View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0308_low_11 (Length: 238)
Name: NF0308_low_11
Description: NF0308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0308_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 106 - 226
Target Start/End: Original strand, 5373429 - 5373549
Alignment:
| Q |
106 |
tagtcgttcaaacttctcttaacaataggtccacaatatgaaatcagccactttaattctgccggttagatattaaggactacatgacaaattttcatca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5373429 |
tagtcgttcaaacttctcttaacaataggtccacaatatgaaatcagccactttaattctgccggttagatattaaggactacatgacaaattttcatca |
5373528 |
T |
 |
| Q |
206 |
aaatggagagtttcatatatt |
226 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5373529 |
aaatggagagtttcatatatt |
5373549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University