View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0308_low_12 (Length: 221)
Name: NF0308_low_12
Description: NF0308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0308_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 41 - 188
Target Start/End: Original strand, 51919079 - 51919226
Alignment:
| Q |
41 |
tatacataaaagtttatggataataaacccaatggtatagagtgcaacaatttattcaaattgtaaattgcatcccccacattgtatattttgtctcggt |
140 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
51919079 |
tatacataataatttatggataataaacccaattgtatagagtgcaacaatttattcaaattgtaatttgcatcccccacattttatattttgtctcggt |
51919178 |
T |
 |
| Q |
141 |
atacgtacgaagcatattcacggggttttagctcaataaactaagtga |
188 |
Q |
| |
|
|||||||||| |||| |||||||| ||||||||||||| ||||||||| |
|
|
| T |
51919179 |
atacgtacgatgcatgttcacgggtttttagctcaatagactaagtga |
51919226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University