View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0309_high_12 (Length: 251)

Name: NF0309_high_12
Description: NF0309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0309_high_12
NF0309_high_12
[»] chr8 (1 HSPs)
chr8 (5-184)||(354574-354754)


Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 5 - 184
Target Start/End: Complemental strand, 354754 - 354574
Alignment:
5 ctctcacaggtaatcatttcgattcttttcagtatatgggtttgtgttcaaatttaacaatttgcgattgttctgtttttgatcggggaaatttattcat 104  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
354754 ctctctcaggtaatcatttcgattcttttcagtatatgggtttgtgttcaaatttaacaatttgcgattgttctgtttttgatcggggaaatttattcat 354655  T
105 -ttttatgtcggattttattggggaaatttaaaaatgcgattttaggttaaattcgtttctgggtcggtgttaaaatgcga 184  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
354654 tttttatgtcggattttattggggaaatttaaaaatgcgattttaggttaaattcgtttctgggtcggtgttaaaatgcga 354574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University