View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0309_high_8 (Length: 325)
Name: NF0309_high_8
Description: NF0309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0309_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 94 - 296
Target Start/End: Original strand, 4012201 - 4012403
Alignment:
| Q |
94 |
caacctgcgaccagaaaccgggtcgggacgggtctgagttttgaaaacgggtttacactcaaaactcaatggttttatgcgatttttgatgggtttcgac |
193 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4012201 |
caacccgcgaccagaaaccgggtcgggacgggtctgagttttgaaaatgggttttcactcaaaactcaatggttttatgcaatttttgatgggtttcgac |
4012300 |
T |
 |
| Q |
194 |
cggaattcaatttccaattcaccacacacaagaatcgcaaggaaaaacatcacaatctagttattgaacacaaaagagaaccggatgtatttcatgaaaa |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4012301 |
cggaattcaatttccaattcaccacacacaagaatcgcaaggaaaaacatcataatctagttattgaacacaaaagagaaccagatgtatttcatgaaaa |
4012400 |
T |
 |
| Q |
294 |
aac |
296 |
Q |
| |
|
||| |
|
|
| T |
4012401 |
aac |
4012403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 11 - 50
Target Start/End: Original strand, 4012161 - 4012200
Alignment:
| Q |
11 |
cacagaggccacacgcgcctgcactctctctggctgagag |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4012161 |
cacagaggccacacgcgcctgcactctctctggctgagag |
4012200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University