View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0309_low_16 (Length: 278)
Name: NF0309_low_16
Description: NF0309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0309_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 80 - 229
Target Start/End: Complemental strand, 9347759 - 9347613
Alignment:
Q |
80 |
gtttggataaactttttgactataacttgcaatatattttctttgaaatgttattggctatgactaaacttatttgttatgaacttatgatccattagag |
179 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
9347759 |
gtttggattaactttttgactataacttgcaatatattttctttgaaatgttattggctatgactaaacttatttgttatgaacttattatccattagag |
9347660 |
T |
 |
Q |
180 |
atacatttatcagtcataatctgatatatttgtcttttggtctaacaaga |
229 |
Q |
|
|
||||| || |||||||||||||||||||| |||||||||||||||||| |
|
|
T |
9347659 |
atacactt---agtcataatctgatatatttttcttttggtctaacaaga |
9347613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 55 - 147
Target Start/End: Complemental strand, 9369411 - 9369315
Alignment:
Q |
55 |
cattagtgtgcttaggtttatgttcgtttggataaactttttgactataacttgcaatatattttctttga-----aatgttattggctatgactaaa |
147 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
T |
9369411 |
cattagtgtgcttag-tttatgttcgtttggataaactttttgactataacttgcaatgtattttctttgaaatgaaatgttattggctatgactaaa |
9369315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 9431700 - 9431625
Alignment:
Q |
150 |
tatttgttatgaacttatgatccattagagatacatttatcagtcataatctgatatatttgtcttttggtctaac |
225 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| ||||||||||||||| |
|
|
T |
9431700 |
tatttgttatgaacttatgatccattagagatacacttatcagttataatctgatatattcgtcttttggtctaac |
9431625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 9410691 - 9410616
Alignment:
Q |
150 |
tatttgttatgaacttatgatccattagagatacatttatcagtcataatctgatatatttgtcttttggtctaac |
225 |
Q |
|
|
||||||||||||||||||||||| |||||||||| |||||||| |||||||| ||||| |||||||||||||||| |
|
|
T |
9410691 |
tatttgttatgaacttatgatcctttagagatactgttatcagttataatctgctatatgtgtcttttggtctaac |
9410616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 150 - 225
Target Start/End: Complemental strand, 9419387 - 9419312
Alignment:
Q |
150 |
tatttgttatgaacttatgatccattagagatacatttatcagtcataatctgatatatttgtcttttggtctaac |
225 |
Q |
|
|
|||||||||||||||||||||| ||||||||||| ||||| || ||||||||| |||| |||| ||||||||||| |
|
|
T |
9419387 |
tatttgttatgaacttatgatcgattagagatacccttatctgttataatctgaaatatgtgtcgtttggtctaac |
9419312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 164 - 207
Target Start/End: Complemental strand, 9368915 - 9368872
Alignment:
Q |
164 |
ttatgatccattagagatacatttatcagtcataatctgatata |
207 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
9368915 |
ttatgatccattagagatacacttatcagtcataatctgatata |
9368872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 150 - 183
Target Start/End: Complemental strand, 9400859 - 9400826
Alignment:
Q |
150 |
tatttgttatgaacttatgatccattagagatac |
183 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
9400859 |
tatttgttatgaacttatgatccattagagatac |
9400826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 150 - 183
Target Start/End: Complemental strand, 9411929 - 9411896
Alignment:
Q |
150 |
tatttgttatgaacttatgatccattagagatac |
183 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
9411929 |
tatttgttatgaacttatgatccattagagatac |
9411896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University