View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0309_low_20 (Length: 251)
Name: NF0309_low_20
Description: NF0309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0309_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 5 - 184
Target Start/End: Complemental strand, 354754 - 354574
Alignment:
| Q |
5 |
ctctcacaggtaatcatttcgattcttttcagtatatgggtttgtgttcaaatttaacaatttgcgattgttctgtttttgatcggggaaatttattcat |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
354754 |
ctctctcaggtaatcatttcgattcttttcagtatatgggtttgtgttcaaatttaacaatttgcgattgttctgtttttgatcggggaaatttattcat |
354655 |
T |
 |
| Q |
105 |
-ttttatgtcggattttattggggaaatttaaaaatgcgattttaggttaaattcgtttctgggtcggtgttaaaatgcga |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
354654 |
tttttatgtcggattttattggggaaatttaaaaatgcgattttaggttaaattcgtttctgggtcggtgttaaaatgcga |
354574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University