View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0311-INSERTION-1 (Length: 377)
Name: NF0311-INSERTION-1
Description: NF0311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0311-INSERTION-1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 6e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 195 - 376
Target Start/End: Original strand, 26411955 - 26412136
Alignment:
| Q |
195 |
caattgtgttgaagattgtcaccataacaaacagtactgattaattaattgtgccgttggtttgattactctgccttcttttattggaaatttgttatta |
294 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26411955 |
caattgtgttgaagattgtcaccataacgaacagtactgattaattaattgtgccgttggtttgattactctgccttcttttattggaaatttgttatta |
26412054 |
T |
 |
| Q |
295 |
tgccctgcatgtttctcagatcaaggaatctaactagatttgtgtgattaactgtacggattatctaactagttagtgttaa |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26412055 |
tgccctgcatgtttctcagatcaaggaatctaactagatttgtgtgattaactgtacggattatctaactagttagtgttaa |
26412136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 2 - 173
Target Start/End: Original strand, 26412133 - 26412304
Alignment:
| Q |
2 |
ttaagttctgcttaagtttcatcacattctagaatgctaaacttttgtctccatcacttattatatgtcactttagatacgcctgttttttaagacgttg |
101 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26412133 |
ttaacttcttcttaagtttcatcacattctagaatgctaaacttttgtctccatcacttattatatgtcactttagatacgcctgttttttaagatgttg |
26412232 |
T |
 |
| Q |
102 |
gtttttgaaatgttggaatctgttttatatataatgcactatacttttttcttgtgggagtaccaaccaatt |
173 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26412233 |
gtttctgaaatgttggaatctgttttatatataatgcactatacttttttcttgtgggagtaccaaccaatt |
26412304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 170 - 200
Target Start/End: Original strand, 35354381 - 35354411
Alignment:
| Q |
170 |
aattcgaacaagttgatagagaaaccaattg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35354381 |
aattcgaacaagttgatagagaaaccaattg |
35354411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University