View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0311-INSERTION-3 (Length: 363)
Name: NF0311-INSERTION-3
Description: NF0311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0311-INSERTION-3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 7509098 - 7509182
Alignment:
Q |
1 |
ttgtcaaactcttgctttggtaaatcaaatttcttcctctccccattttgaattgcattaaggagaatggaggcaccttgcttca |
85 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
7509098 |
ttgtcaacctcttgctttggtaaatcaaatttcttcctctccccattttgaattgcattaaggagaatggtggcaccttgcttca |
7509182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 19 - 70
Target Start/End: Complemental strand, 27241558 - 27241507
Alignment:
Q |
19 |
ggtaaatcaaatttcttcctctccccattttgaattgcattaaggagaatgg |
70 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
27241558 |
ggtaaatcaaatttcttcctctcaccattttgaattgcattaagaagaatgg |
27241507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 5 - 70
Target Start/End: Complemental strand, 27249177 - 27249113
Alignment:
Q |
5 |
caaactcttgctttggtaaatcaaatttcttcctctccccattttgaattgcattaaggagaatgg |
70 |
Q |
|
|
||||||||| ||| ||| |||| |||||||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
27249177 |
caaactctt-cttgggttaatcgaatttcttcctctcgccattttgaattgcattaagaagaatgg |
27249113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University