View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0313_high_2 (Length: 402)
Name: NF0313_high_2
Description: NF0313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0313_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 3289561 - 3289773
Alignment:
| Q |
1 |
tataagatatagttggaaaaaaataatagttcatatttcatnnnnnnnnnnnnnnnntacaattattttggaacaaatatttttccacc-agggagagta |
99 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3289561 |
tataagatatagttg-aaaaaaataatagttcatatttcataaaaaaaaattaaaaatacaattattttggaacaaatatttttccaccgagggagagta |
3289659 |
T |
|
| Q |
100 |
tagttctaggtaggggctagtaaatgtttatactttatagacaacaagaatcccatagtcccatatatgtcgaccttttgagaccgaaacccagcatgtg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3289660 |
tagttctaggtaggggctagtaaatgttta-------tagacaacaagaatcccatagtcccatatatgtcgaccttttgagacccaaacccagcatgtg |
3289752 |
T |
|
| Q |
200 |
gccctttaggttgcttcaagg |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3289753 |
gccctttaggttgcttcaagg |
3289773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1605 times since January 2019
Visitors: 2824